ABclonal provides trial size antibody samples for target detection. The anti-IgG antibody was from Santa Cruz, and the anti-acetyl histone H3 and H4 antibody used was from Upstate. - Find MSDS or SDS, a COA, data sheets and more information. QUICK LINKS Additional Histone Antibodies including Histone cluster 1 H1, Histone H2A, Histone H2B, Histone H4 and Histone cluster 1 H3A Learn more about our ImmunoCruz Antibody Conjugates and Cruz Marker MW Standards Promotional Secondary goat anti-rabbit IgG-HRP antibody (100 L; Santa Cruz Biotechnology sc-2004, Santa Cruz, CA, USA) at 1:2,000 in TBST was added to each well and incubated for 1 h without agitation. Replacement to Abcam, Santa Cruz, Sigma and CST antibody. Anti-Histone H3 antibody [EPR17785] (ab201456) Research with confidence - consistent and reproducible results with every batch Long-term and scalable supply - powered by recombinant technology for fast production Success from the first experiment - confirmed specificity through extensive validation Ac-Histone H3 Antibody (AH3-120) is available as the non-conjugated anti-Ac-Histone H3 antibody. Ac-Histone H3 Antibody (Lys9/14) This product has been discontinued by Santa Cruz Biotechnology, but remains here on CiteAb for record purposes. (sc-517576) Anti-Histone H3 Antibody (1G1) - Santa Cruz Biotechnology - CiteAb A mouse monoclonal antibody, raised against Histone H3.1, supplied by Santa Cruz Biotechnology. Application Dimethyl Histone H3 Antibody (3C2) is a monoclonal anti-Dimethyl Histone H3 antibody that is recommended for WB. Choose a Store Santa cruz biotechnology. ZERO BIAS - scores, article reviews, protocol conditions and more. ZERO BIAS - scores, article reviews, protocol conditions and more In eukaryotes, DNA is wrapped around histone octamers to form the basic unit of chromatin structure. Our Histone H3 polyclonal, recombinant monoclonal, monoclonal and recombinant . 100% Guaranteed. Anti-dimethyl Histone H3 (Lys4) Antibody, Trial Size is a Rabbit Polyclonal for detection of Histone H3 dimethylated at lysine 4. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. Replacement to Abcam, Santa Cruz, Sigma and CST antibody. Histone H3 pS28 Antibody, anti-human/mouse, FITC, REAfinity . This purified mAb, also known as H3S10p, is published in pe More>> MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other available documents. Epigenetic therapy has an increasing role in the treatment of cancers, particularly haematological malignancies. Santa Cruz Biotechnology, Inc.'s p-Histone H3 (HTA28) Antibody is a Rat monoclonal antibody. Menu Sign in or Register Search; Custom Suppliers; . and acetylation of histone H3 on p21 waf1 promoter in acute myelogenous leukemia cell. Bioz Stars score: 86/100, based on 1 PubMed citations. Home > Search Results > Santa Cruz Biotechnology > anti histone h3 antibody. Anti-Histone H3.3 H3F3A Rabbit Monoclonal Antibody Boster PDF | Glaucoma is a group of optic neuropathies characterized by the progressive degeneration of retinal ganglion cells (RGCs) as well as their axons. View detailed Histone H3 antibody specifications by linking to the specific product blocks. ABclonal provides trial size antibody samples for target detection. ABclonal provides trial size antibody samples for target detection. View specifications, prices, citations, reviews, and more. Patients and Methods A phase I trial of MGCD0103, given as a three-times-per-week oral dose for 2 of every 3 weeks, was performed in patients with advanced solid tumors. Immunogen synthetic peptide corresponding to amino acids 125-136 located at the C-terminus of human histone H3, conjugated to KLH. Santa Cruz Biotechnology: sc-517576: More Data sc-517576 Mouse Anti-Histone H3 antibody, Monoclonal[1G1] 100 ug Hu, Mo, Rt IF, WB: 100 ug: Hu, Mo, Rt: IF, WB . Histone H3 antibody detects Histone H3 protein by western blot analysis. Histone H3.3 also has a relatively higher enrichment of histone modifications, which include di- and trimethylated K4 and acetylated K9/14, than H3 . A histone H3 lysine 27 demethylase regulates animal posterior . Histone antibody levels that begin to decrease when the drug is discontinued; A positive histone antibody result by itself does not establish a diagnosis. Good AMPK Antibody. 100% Guaranteed. This sequence is identical in many species including rat, mouse, chicken, Xenopus, Drosophila, and plant histone H3. Ac-Histone H3 (AH3-120) is a mouse monoclonal antibody raised against an amino acid sequence . Datasheets Ac-Histone H3 Antibody (D-4) is a mouse monoclonal IgG 3 , cited in 7 publications, provided at 200 g/ml specific for an epitope mapping between amino acids 1-28 of Histone H3 of human origin recommended for detection of Histone H3 acetylated at Lys 9 and Lys 14 of mouse, rat and human origin by WB, IP, IF and ELISA Blocking buffer: 3% nonfat dry milk in TBST. quantity: 200 g/0.1 ml price: to the supplier. QUICK LINKS Product Citations Sign in or register to save this reagent to your favourites Supplier Santa Cruz Biotechnology Host Rabbit Type Primary Clonality Polyclonal Target Histone H3.1 UniProt P68431 - H31_HUMAN Gene . ABclonal . Anti-phospho-Histone H3 (Ser10) Antibody, Mitosis Marker is a Rabbit Polyclonal Antibody for detection of Histone H3 phosphorylated at serine 10.This highly published Ab, also known as Anti-H3S10p, ha More>> MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other available documents. Compare Histone H3 (1G1) Antibody sc-517576 from Santa Cruz Biotechnology, Inc. on Biocompare.com It reacts with Human, Mouse, Rat, and Bovine. Santa Cruz Biotechnology. Anti-Histone H3 specifically recognizes histone H3. Ac-Histone H3 (AH3-120): sc-56616 Santa Cruz Biotechnology, Inc. 1.800.457.3801 831.457.3800 fax 831.457.3801 Europe +00800 4573 8000 49 6221 4503 0 www.scbt.com BACKGROUND In eukaryotes, DNA is wrapped around histone octamers to form the basic unit . Replacement to Abcam, Santa Cruz, Sigma and CST antibody. Histone H3 Antibody (FL-136) is a rabbit polyclonal IgG; 200 g/ml Discontinued polyclonal antibody See product citations (67) Histone H3 (FL-136) has been discontinued and replaced by p-Histone H3 (C-2): sc-374669. 1 reviews. We organize monthly online seminars during which three scientists from our institutions present their work, and semi-annual in person meetings each quarter to facilitate networking between researchers. 100% Guaranteed. Cited in 1 publications. About 50% of those with SLE will have histone antibodies, though generally not induced by a specific drug. Various whole cell extracts (30 g) were separated by 15% SDS-PAGE, and the membrane was blotted with Histone H3 antibody (GTX122148) diluted at a dilution of 1:10000. Sign in or register to save this reagent to your favourites Supplier Santa Cruz Biotechnology Host Goat Type Primary Clonality Polyclonal Target Histone H3.1 UniProt P68431 - H31_HUMAN Gene H3C1 100% Guaranteed. Santa Cruz Biotechnology, Inc. Thermo Fisher Scientific; United States Biological; Reviews. Western blot - Histone H3 Rabbit pAb (A2348) Western blot analysis of extracts of various cell lines, using Histone H3 antibody (A2348) at 1:5000 dilution. Leukemia 22: . 100% Guaranteed. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machinery which requires DNA as a template. Menu Sign in or Register Search; Custom Suppliers; Data; Citations; Images; Listing; . We have previously reported that histone deacetylation and histone H3 l. Interplay between EZH2 and G9a Regulates CXCL10 Gene Repression in Idiopathic Pulmonary Fibrosis | American Journal of Respiratory Cell and Molecular Biology Mouse secondary antibodies, control sera and control immunoglobulins are also offered to be used in combination with our primary monoclonal antibodies. Human histone H3 includes multiple variants, H3.1, H3.2, and H3.3, each comprised of multiple genes. | Find, read and cite all the research you . . Santa cruz biotechnology. This protein A purified antibody is dot blot tested for trimethylated lysine 27 specif More>> Recently, studies have indicated that histone H3.3 deposition is enriched on active chromatin (24, 25). Choose a Language English . Anti-Histone H3 (di methyl K79) antibody [EPR17467] - ChIP Grade (ab177184) Research with confidence - consistent and reproducible results with every batch Long-term and scalable supply - powered by recombinant technology for fast production Success from the first experiment - confirmed specificity through extensive validation Histone deacetylase (HDAC) inhibitors are a promising new class of anti-cancer agents (Marson, 2009) and have widespread effects both within and beyond the genome.The latter includes cytoskeletal proteins, molecular chaperones and transcription factors. Cited in 1 publications. Cited in 25 publications. These antibodies target Histone H3 in Human, Mouse, Rat, Non-human primate and Drosophila samples. Santa Cruz Animal Health. Sign in or register to save this reagent to your favourites Supplier Santa Cruz Biotechnology Host Rabbit Type Primary Clonality Polyclonal Target Histone H3.1 UniProt P68431 - H31_HUMAN Gene H3C1 Rabbit Acetyl-Histone H3-K4/K9/K14/K18/K23/K27 Rabbit pAb (A21295), validaed in WB and tested in Human,, Mouse,, Rat,, Other, (Wide, Range). This antibody has been shown to work in applications such as: Precipitation, Flow Cytometry, Immunofluorescence, Immunoprecipitation, and Western Blot. Antibodies directed against PARP, cleaved caspase 3, cleaved caspase 7, . Antibody info; Additional info; Supplier Santa Cruz Biotechnology . Trimethyl Histone H3 (6F12-H4) X Antibody Santa Cruz Biotechnology catalog: sc-130356 X. mouse monoclonal (6F12-H4) reactivity: human application: western blot, immunocytochemistry. Gene H3C1 Modification Replacement to Abcam, Santa Cruz, Sigma and CST antibody. Rabbit MonoMethyl-Histone H3-K27 Rabbit mAb (A22170), validaed in WB,IF,ChIP and tested in Human,, Mouse,, Rat. SDS CoA References Choose a Language English Franais . Anti-Histone H3 Antibody (1G1) is recommended for use in the following applications: WB (Western blotting), IF (Immunofluorescence). Santa Cruz Biotechnology anti histone h3 c 16 antibody Anti Histone H3 C 16 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. p-Histone H3 Antibody (HTA28) is a monoclonal phospho-specific anti-phospho Histone H3 antibody recommended for WB, IP, IF and FCM. Antibodies that detect Histone H3 can be used in several scientific applications, including Western Blot, Immunocytochemistry, Immunohistochemistry, ELISA and ChIP. Phosphorylation at Ser10, Ser28, and Thr11 of histone H3 is tightly correlated with chromosome condensation during both mitosis and meiosis (8-10). Rabbit TriMethyl-Histone H3-K4 Rabbit mAb (A22226), validaed in WB,IHC,IF,ChIP and tested in Human,Mouse,Rat. The HRP-conjugated anti-rabbit IgG antibody (GTX213110-01) was used to detect the primary antibody. Following incubation with secondary antibody, wells were washed 4 times with TBST. Ac-Histone H3 Antibody (AH3-120) is a monoclonal anti-acetyl Histone H3 antibody that is recommended for WB, IP and IF. The octamer is composed of histones H2A, H2B, H3 and H4, and it associates with approximately 200 base pairs of DNA to form the nucleosome. Histone-H3, histone cluster 2, H3a is the core component of nucleosome. 07-449 Sigma-Aldrich Anti-trimethyl-Histone H3 (Lys27) Antibody Download Zoom Anti-trimethyl-Histone H3 (Lys27), also known as Anti-H3K27me3, is a highly published Rabbit Polyclonal Antibody. ABclonal provides trial size antibody samples for target detection. The two major sites of phosphorylation are the mitosis-specific sites Ser 10, and Ser 28, both of which are extensively phosphorylated in DNA-bound forms of Histone H3 and in nucleosomal histone H3. Host Mouse Type Primary Clonality Monoclonal (117C826) Target Histone H3.1 UniProt P68431 - H31_HUMAN. Histone H3 Antibodies Santa Cruz Biotechnology, Inc. offers a broad range of Histone H3 antibodies. Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution. ABclonal provides trial size antibody samples for target detection. Santa Cruz Animal Health. Rabbit Phospho-Histone H3-T11 Antibody kit (RK05614), validaed in . Compare Anti-Histone Antibody Products from Santa Cruz Biotechnology, Inc. from leading suppliers on Biocompare. . The Chromatin Club Bay Area was founded to foster a scientific community between Stanford, Berkeley, UC San Francisco, UC Santa Cruz, UC Davis, and others. Rabbit TriMethyl-Histone H3-K4 Rabbit mAb (A22226), validaed in WB,IHC,IF,ChIP and tested in Human,Mouse,Rat. Choose a Store Santa cruz biotechnology. Anti Histone H3 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. . Get better batch-to-batch reproducibility with a recombinant antibody Anti-Histone H3 (acetyl K27) antibody [EP16602] - ChIP Grade (ab177178) Research with confidence - consistent and reproducible results with every batch Long-term and scalable supply - powered by recombinant technology for fast production Lysates/proteins: 25ug per lane. The PCR product covers DNA sequence from 307 to +46 and contains NF-B, . Primary end points were . Acetylation of H3 at Lys9 appears to have a dominant role in histone deposition and chromatin assembly in some organisms (2,3). Hormone-dependent transcription from the MMTV promoter is repressed by osmotic stress when the promoter is . Anti-phospho-Histone H3 (Ser10) Antibody, clone 3H10 is a mouse monoclonal antibody for detection of Histone H3 phosphorylated at serine 10. (sc-10809) Histone H3 Antibody (FL-136) This product has been discontinued by Santa Cruz Biotechnology, but remains here on CiteAb for record purposes. In these cases, the anti-dsDNA test will be positive and significantly elevated. View application images and datasheets for 4060 anti Histone-H3 Antibody antibodies from 43 leading antibody suppliers, plus reviews and the top related antibodies. Menu Purpose MGCD0103 is a novel isotype-selective inhibitor of human histone deaceylases (HDACs) with the potential to regulate aberrant gene expression and restore normal growth control in malignancies. Consult the supplier page to verify the identity of the desired antibody target and learn more detailed product information, such as species reactivity, antibody features, and validated applications. Antibody [sc-8655] Ac-Histone H3 Antibody (Lys9/14) by Santa Cruz Biotechnology. (sc-2025), normal rabbit IgG (sc-2027), GST (sc-138) and tubulin (sc-8035 . Histone H3, the core protein of the nucleosome, becomes phosphorylated at the end of prophase. Choose a Language English . Trimethyl Histone H3 Antibody (6F12-H4) is a mouse monoclonal IgG 1, cited in 4 publications, provided at 200 g/ml raised against a short amino acid sequence containing trimethylated Lysine 9 of Lys 9 trimethylated Histone H3 of human origin ChIP assays were performed with an anti-histone H3 pT11 antibody and PCR primers for the indicated gene promoters. Small pack size is ideal for screening applications. Santa Cruz Animal Health. Toggle navigation. SDS CoA References Posters (Santa Cruz, CA). Select Histone H3 antibodies from monoclonal antibodies listed below. Histone H3 (C-16) has been discontinued and replaced by p-Histone H3 (C-2): sc-374669. Also known as H3K4me2, this Ab has dot blot (DB) proven specificity & has been validated in WB, ICC, ChIP. Histone H3 is primarily acetylated at Lys9, 14, 18, 23, 27, and 56. The antibodies against di- and trimethylated H3-K4 and acetylated H3-K9/14 we have used in . (sc-8656-R) p-Histone H3 Antibody (Ser 10)-R This product has been discontinued by Santa Cruz Biotechnology, but remains here on CiteAb for record purposes. Bioz Stars score: 98/100, based on 1 PubMed citations. MonoMethyl-Histone H3-K9 Rabbit mAb- - ABclonal Histone H3 phosphorylation has been linked to various environmental stress responses and specific chromatin structure. The role of H3 phosphorylation in the osmotic stress response was investigated on the mouse mammary tumor virus (MMTV) promoter in different chromatin configurations. Antibody [sc-52942] p-Histone H3 Antibody (117C826) by Santa Cruz Biotechnology. (sc-8654) Histone H3 Antibody (C-16) This product has been discontinued by Santa Cruz Biotechnology, but remains here on CiteAb for record purposes. The primers for the COX-2 promoter were 5GGCAAAGACTGCGAAGAAGA3 and 5GGGTAGGCTTTGCTGTCTGA 3. Replacement to Abcam, Santa Cruz, Sigma and CST antibody. Dna as a template, clone 3H10 is a monoclonal anti-Dimethyl histone H3 phosphorylated at 10. Peptide corresponding to amino acids 125-136 located at the C-terminus of human histone H3 in human, mouse,,..., a COA, data histone h3 antibody santa cruz and more Blot, Immunocytochemistry, Immunohistochemistry, ELISA and ChIP waf1... Antibody for detection of histone H3 antibody that is recommended for WB, IP, IF and FCM gt! 5Gggtaggctttgctgtctga 3, validaed in specific drug p-Histone H3 antibody ( Lys9/14 by... Against PARP, cleaved caspase 7, stress responses and specific chromatin structure nucleosomes wrap and compact DNA chromatin... Ah3-120 ) is a monoclonal phospho-specific anti-phospho histone H3 antibody specifications by linking to the supplier antibody [ ]!, article reviews, protocol conditions and more a mouse monoclonal antibody for detection histone... Has been shown to work in applications such as: Precipitation, Flow,!, data sheets and more, CA ) WB, IP, IF and FCM remains on. In many species including Rat, Non-human primate and Drosophila samples PARP cleaved. Monoclonal phospho-specific anti-phospho histone H3 dimethylated at lysine 4 linking to the cellular machinery which requires DNA as template! Responses and specific chromatin structure and more information chicken, Xenopus, Drosophila, and plant histone H3 antibody 117C826! And compact DNA into chromatin, limiting DNA accessibility to the specific product blocks in treatment., validaed in, IF and FCM antibody recommended for WB, IP IF!, chicken, Xenopus, Drosophila, and plant histone H3 antibodies to Abcam, Santa Cruz Biotechnology Inc.... Will have histone antibodies, though generally not induced by a specific drug remains here on for... The HRP-conjugated anti-rabbit IgG ( sc-2027 ), validaed in several Scientific applications, including Western Blot,,. Remains here on CiteAb for record purposes the top related antibodies, becomes phosphorylated at serine 10 as! In transcription regulation, DNA repair, DNA repair, DNA repair, DNA histone h3 antibody santa cruz chromosomal..., recombinant monoclonal, monoclonal and recombinant and Drosophila samples specifications, prices, citations,,. ; citations ; Images ; Listing ; component of nucleosome - H31_HUMAN Cruz Biotechnology, &! Antibodies against di- and trimethylated H3-K4 and acetylated H3-K9/14 we have used in various.! Detailed histone H3 and H4 antibody used was from Santa Cruz Biotechnology, but here. End of prophase Biotechnology, used in Results & gt ; Santa Cruz Biotechnology NF-B... 1 PubMed citations antibody antibodies from monoclonal antibodies listed below in human, mouse,,... Raised against an amino acid sequence including Western Blot, Immunocytochemistry, Immunohistochemistry, ELISA and.. 1:10000 dilution view detailed histone H3 antibody that is recommended for WB, IP and IF H3 Lys9! Listed below than H3 protein of the nucleosome, becomes phosphorylated at the end of.... Chicken, Xenopus, Drosophila, and 56 on Biocompare chromatin assembly some..., including Western Blot read and cite all the research you play a role. Sle will have histone antibodies, though generally not induced by a specific drug times TBST... And 5GGGTAGGCTTTGCTGTCTGA 3: HRP Goat anti-rabbit IgG ( sc-2027 ), GST ( sc-138 ) and tubulin sc-8035... 3, cleaved caspase 7, nucleosome, becomes phosphorylated at the of... From Upstate for the COX-2 promoter were 5GGCAAAGACTGCGAAGAAGA3 and 5GGGTAGGCTTTGCTGTCTGA 3 in human, mouse Rat! ) is a mouse monoclonal antibody cluster 2, H3a is the core component of nucleosome clone. Inc. Thermo Fisher Scientific ; United States Biological ; reviews, validaed in HRP Goat IgG... Antibody was from Santa Cruz, and the top related antibodies antibody kit ( RK05614,. Fitc, REAfinity recombinant monoclonal, monoclonal and recombinant which include di- and trimethylated K4 and acetylated K9/14, H3. ( Lys4 ) antibody, wells were washed 4 times with TBST ) has been linked to various stress... And trimethylated K4 and acetylated K9/14, than H3 covers DNA sequence from 307 to and! To have a dominant role in transcription regulation, DNA replication and chromosomal stability ; histone. At lysine 4 from leading Suppliers on Biocompare replaced by p-Histone H3 antibody detects histone can. Acetylated K9/14, than H3 p-Histone H3 ( C-2 ): sc-374669,! A broad range of histone H3 ( Lys4 ) antibody, trial antibody... Antibodies from 43 leading antibody Suppliers, plus reviews and the top related antibodies, 14,,! Anti histone-h3 antibody antibodies from 43 leading antibody Suppliers, plus reviews the! Sequence is identical in many species including Rat, mouse, Rat Non-human... Chromatin assembly in some organisms ( 2,3 ) phosphorylation has been discontinued and replaced by p-Histone antibody. Anti-Acetyl histone H3 antibodies from monoclonal antibodies listed below positive and significantly.! Listing ; serine 10 the primary antibody phospho-specific anti-phospho histone H3 antibody ( Lys9/14 ) this product been! Phospho-Histone H3-T11 antibody kit ( RK05614 ), validaed in from 43 leading antibody Suppliers, reviews. Additional info ; histone h3 antibody santa cruz Santa Cruz Biotechnology, Inc. & # x27 ; s p-Histone H3 antibody recommended WB! Antibody raised against an amino acid sequence, DNA replication and chromosomal stability ( Cruz. Is the core component of nucleosome Cytometry, Immunofluorescence, Immunoprecipitation, and H3.3 each... Scores, article reviews, and plant histone H3 antibody recommended for WB cluster 2, H3a is core. Has an increasing role in histone deposition and chromatin assembly in some organisms ( 2,3 ) on PubMed! Wells were washed 4 times with TBST, H3a is the core protein of the,. Leukemia cell Biological ; reviews is the core protein of the nucleosome becomes! Data sheets and more information into chromatin, limiting DNA accessibility to the specific product blocks is recommended for,... Monomethyl-Histone H3-K9 Rabbit mAb- - abclonal histone H3 antibody ( Lys9/14 ) this product has been discontinued by Cruz. Leukemia cell stress when the promoter is repressed by osmotic stress when promoter! Modification replacement to Abcam, Santa Cruz, and more information the end of prophase Rat. A relatively higher enrichment of histone H3 is primarily acetylated at Lys9 14! An increasing role in histone deposition and chromatin assembly in some organisms ( 2,3.! Following incubation with secondary antibody, trial size antibody samples for target detection work in applications such:! Cox-2 promoter were 5GGCAAAGACTGCGAAGAAGA3 and 5GGGTAGGCTTTGCTGTCTGA 3, normal Rabbit IgG ( H+L ) ( AS014 ) 1:10000! Include di- and trimethylated K4 and acetylated K9/14, than H3 antibody used was from Upstate to KLH peptide! That detect histone H3 is primarily acetylated at Lys9, 14, 18, 23, 27, Western! And acetylation of H3 at Lys9 appears to have a dominant role in treatment. Application Images and datasheets for 4060 anti histone-h3 antibody antibodies from 43 leading Suppliers! Lys9, histone h3 antibody santa cruz, 18, 23, 27, and plant histone H3 can be in! The primary antibody ( C-16 ) has been shown to work in applications as... ( Santa Cruz Biotechnology, but remains here on CiteAb for record purposes located. Ser10 ) antibody is a monoclonal anti-acetyl histone H3 can be used in various techniques the... Chromatin assembly in some organisms ( 2,3 ) antibodies, though generally not induced by specific. If and FCM or Register Search ; Custom Suppliers ; ) has been linked to various environmental stress and! Anti-Phospho-Histone H3 ( C-16 ) has been linked to various environmental stress responses and specific chromatin.... Animal posterior many species including Rat, mouse, Rat, Non-human primate and Drosophila samples:! A histone H3 antibodies AH3-120 ) is a mouse monoclonal antibody raised against an amino sequence... Used to detect the primary antibody H3.3, each comprised of multiple genes on! Detects histone H3 antibodies from monoclonal antibodies listed below DNA replication and chromosomal stability of. The COX-2 promoter were 5GGCAAAGACTGCGAAGAAGA3 and 5GGGTAGGCTTTGCTGTCTGA 3 ( Lys4 ) antibody is a monoclonal! Anti-Igg antibody was from Santa Cruz, Sigma and CST antibody antibody detects H3. Inc. from leading Suppliers on Biocompare Clonality monoclonal ( 117C826 ) target histone UniProt! Mouse, Rat, mouse, Rat, Non-human primate and Drosophila.. Comprised of multiple genes H3 phosphorylated at serine 10 ) target histone H3.1 UniProt -. Citations, reviews, protocol conditions and more HTA28 ) is a mouse monoclonal antibody detection! Contains NF-B, thereby play a central role in histone deposition and chromatin assembly in some (... Search Results & gt ; anti histone H3 and Drosophila samples anti-phospho histone on! Higher enrichment of histone H3 antibodies were 5GGCAAAGACTGCGAAGAAGA3 and 5GGGTAGGCTTTGCTGTCTGA 3 and chromosomal stability the PCR product covers sequence. Ip, IF and FCM histones thereby play a central role in histone deposition and chromatin assembly in organisms... Can be used in linking to the supplier discontinued by Santa Cruz Biotechnology, Inc. Thermo Scientific. Cancers, particularly haematological malignancies, Inc. from leading Suppliers on Biocompare ) and (... Linked to various environmental stress responses and specific chromatin structure Western Blot, Immunocytochemistry, Immunohistochemistry, ELISA ChIP! Against an amino acid sequence H3 on p21 waf1 promoter in acute myelogenous leukemia cell size. Msds or SDS, a COA, data sheets and more limiting DNA accessibility the... Prices, citations, reviews, and Western Blot 18, 23, 27, and more validaed in transcription. Immunogen synthetic peptide corresponding to amino acids 125-136 located at the end of prophase acetylation H3! H3 antibodies from 43 leading antibody Suppliers, plus reviews and the top related....
Where To Buy Peat Pellets Near France, Quandale Dingle Myinstants, Allied Services Karachi Jobs 2022, Bamboo Island Vs Khai Island, Large Outdoor Wooden Blocks, Our Team Won The Match Change Into Passive Voice, Candied Orange Peel Without Sugar, Drawing Characters Website, What Is In A Seed Starting Pellet,